Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 15726

#SCPH05 I Biotechnology

Tissues and cells cultured in a liquid medium produce culture of single cells and cells clumps of few to many cells

TLS Online TPP Program

#Question id: 19140

#I Life Science/ Life Sciences Group – I-V

You have two distantly related proteins. Which of the following matrix is the best for comparing them? 

TLS Online TPP Program

#Question id: 3622

#SCPH28 | Zoology

Two allelic genes are situated on

TLS Online TPP Program

#Question id: 19641

#SCPH05 I Biotechnology

A miscible mixture of benzene and chloroform can be separated by:

TLS Online TPP Program

#Question id: 15911

#SCPH05 I Biotechnology

Multiple sequence alignments are used to derive