Which of the following is not used for generating an optimal alignment of two nucleotide sequences

TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 22957

#SCPH28 | Zoology

floral organ development is controlled by overlapping expressions of A class , B class and C class genes in different whorls. In an Arabidopsis mutant, the floral whorls had following pattern:

Sepal àSepal àcarpel àcarpel 

Mutation in which one of the following class of gene causes above pattern.  

TLS Online TPP Program

#Question id: 2329

#SCPH06 I Botany

Which of the following would be a problem for a cell if it were able to grow to twice its normal size?

TLS Online TPP Program

#Question id: 13079

#SCPH01 Biochemistry

Name of that sophisticated equipment which used to the oligonucleotide, that serve as a primer in RAPDs is usually obtained by in vitro DNA synthesis,

TLS Online TPP Program

#Question id: 4159

#SCPH01 Biochemistry

Which statement is not true about the ʺwobbleʺ position?