TLS Online TPP Program

#Question id: 2690


What do you think is the requirement of Intergenic DNA in higher organisms?

#SCPH05 I Biotechnology
  1. Just genetic load

  2. To avoid viable mutations

  3. Helps in regulation of transcription

  4. Helps in genome organization

More Questions
TLS Online TPP Program

#Question id: 18074

#SCPH05 I Biotechnology

Affinity chromatography on oligo(dT)-cellulose columns, is used for eukaryotic mRNA extraction, instead of using oligo(dT)-cellulose we can also use

TLS Online TPP Program

#Question id: 14734

#SCPH05 I Biotechnology

Among the following which bacteria shows corkscrew movement?
1. Treponema pallidum
2. Leptospira
3. Borrelia burgdorferi
4. Brachyspira pilosicoli
Which among the following combination is correct?

TLS Online TPP Program

#Question id: 13100

#SCPH01 Biochemistry

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 5425

#SCPH06 I Botany

Two varieties of maize averaging 50 and 20 inches in height, respectively, are crossed. The F1 progeny is quite uniform averaging 35 inches in height. Out Of the 16 F2 plants, the 5 are 35 inches. What is the probable number of independent segregating polygenes involved in this trait?

TLS Online TPP Program

#Question id: 10813

#SCPH05 I Biotechnology

A living cytoplasmic connection penetrate the walls between sieve tube elements and their companion cells; which are often complex and branched on the companion cell side, known as