Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 44795
TLS Online TPP Program

#Question id: 4724

Which of the following are true about crossing over ?

#SCPH06 I Botany

  1. crossing over lead to homologous chromosome become identical

  2. crossing over lead to non-sister chromosome become identical

  3. crossing over lead to sister chromosome become identical

  4. crossing over lead to sister chromosome become non-identical

More Questions
TLS Online TPP Program

#Question id: 549

#SCPH28 | Zoology

Which one of the following statements is true of enzyme catalysts?
TLS Online TPP Program

#Question id: 13095

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.
TLS Online TPP Program

#Question id: 345

#SCPH05 I Biotechnology

As the [H3O+] of the solution decreases, the [OH-] ________.
TLS Online TPP Program

#Question id: 614

#SCPH05 I Biotechnology

What type of inhibition is indicated by the data graphed below?
TLS Online TPP Program

#Question id: 18215

#I Life Science/ Life Sciences Group – I-V

Serial analysis of gene expression (SAGE) is used for