Movement of epithelial cells as a unit to enclose deeper layers of the embryo. This type of cell movement during gastrulation occur in:

TLS Online TPP Program

#Question id: 1625

#SCPH01 Biochemistry

The NLRP3 inflammasome leads to the release of:

TLS Online TPP Program

#Question id: 3886

#SCPH01 Biochemistry

Which one of the following statements about the reverse transcriptases of retroviruses and the RNA replicases of other single-stranded RNA viruses, such as R17 and influenza virus, is correct?

TLS Online TPP Program

#Question id: 15229

#SCPH01 Biochemistry

Output of Capillary electrophoresis (CE) is called

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14218

#SCPH05 I Biotechnology

In CSTR system at steady rate