TLS Online TPP Program

#Question id: 4589


Darwin used the phrase "descent with modification" to explain ________.

#SCPH06 I Botany
  1. unity of life

  2. descent of all organisms from a single, ancient ancestor

  3. that habitat differences stimulate change in organisms

  4. evolution of the unity and diversity of life

More Questions
TLS Online TPP Program

#Question id: 23253

#SCPH01 Biochemistry

FISH is an in vitro assay that uses fluorescent reporter attached to a _______ that hybridizes to chromosomes.

TLS Online TPP Program

#Question id: 2100

#SCPH01 Biochemistry

Cholesterol, bile acids, ergosterol, and stigmasterol share all the following common structural features except

TLS Online TPP Program

#Question id: 19333

#SCPH01 Biochemistry

HRP is one of the type of compound biosensor. What is the full form of HRP?

TLS Online TPP Program

#Question id: 9587

#SCPH05 I Biotechnology

The structure of the four major protein complexes in the thylakoid membrane are organised form such as ;

a.) PSII is located predominantly in the stacked regions of the thylakoid membrane and Cytochrome b6f complexes are evenly distributed

b.) PSI and ATP synthase are found in the unstacked regions protruding into the stroma

c.) Lateral separation of the two photosystems requires that electrons and protons produced by PSII be transported directly to PSI and the ATP coupling enzyme

d.) Four main protein complexes of the thylakoid membrane, shown also are the two diffusible electron carriers—plastocyanin, which is located in the thylakoid lumen, and plastohydroquinone (PQH2) in the membrane, The lumen has a positive electrical charge with respect to the stroma

Which of the following statements correct?

TLS Online TPP Program

#Question id: 13095

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.