Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 45687
TLS Online TPP Program

#Question id: 8287

The following phylogeny shows six living species (a-f) and five ancestral (now extinct) species (#1-5). If the phylogeny had been developed on the basis of similarities in bone structure, which of the following predictions would you make in terms of the structure of a particular enzyme?


#SCPH06 I Botany
  1. The enzymes of species b and f are very similar.
  2. The enzymes of species b and c are more similar to ancestor #4 than to ancestor 2
  3. The enzymes of species a and b are the same as that of ancestor #2.
  4. The enzyme of species c is very similar to that of species d.
More Questions
TLS Online TPP Program

#Question id: 14116

#SCPH05 I Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 
TLS Online TPP Program

#Question id: 14117

#SCPH01 Biochemistry

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#I Life Science/ Life Sciences Group – I-V

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG