Assume that long ear lobes in humans are an autosomal dominant trait that exhibits 50% penetrance. A person who is heterozygous for long ear lobes mates with a person who is homozygous for normal ear lobes. What is the probability that their first child will have long ear lobes.

TLS Online TPP Program

#Question id: 40

#SCPH06 I Botany

Given that the standard free-energy change for the reaction glucose + Pi → glucose 6-phosphate is 13.8 kJ/mol, and the standard free-energy change for the reaction ATP → ADP + Pi is −30.5 kJ/mol, what is the free-energy change for the reaction glucose + ATP → glucose 6-phosphate + ADP?

TLS Online TPP Program

#Question id: 14828

#SCPH05 I Biotechnology

Pili are usually longer than fimbriae and number only one or two per cell. Pili are involved in motility and DNA transfer. The type of motility, called 

1. Extrusion

2. Somersaulting

3. Twitching motility 

4. Gliding motility

Which combination from the following is correct?

TLS Online TPP Program

#Question id: 11078

#SCPH28 | Zoology

A child has been eating round candies approximately 1 and 1.5 cm in diameter and inhaled one down his airway blocking his left bronchiole. Which of the following will describe the changes that occur?

TLS Online TPP Program

#Question id: 1093

#SCPH01 Biochemistry

Which of the following activities would be inhibited by a drug that specifically blocks the addition of phosphate groups to proteins?

TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?