Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 48592
TLS Online TPP Program

#Question id: 11448

Artificial electrical stimulation of a human's capsaicin-sensitive neurons would likely produce the sensation of ________.

#SCPH28 | Zoology
  1. cold temperature
  2. hot temperature
  3. tactile stimulus
  4. deep pressure
More Questions
TLS Online TPP Program

#Question id: 3551

#SCPH12 I Genetics

In angiosperm plant, assume that the male parent has an AA Bb genotype, and that the female parent has an aa BB genotype. What is genotype in endosperm nucleus, after reproduction between these two plants?
TLS Online TPP Program

#Question id: 13095

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.
TLS Online TPP Program

#Question id: 12724

#SCPH06 I Botany

In response to sudden, 5 to 10°C rises in temperature, plants produce a unique set of proteins referred to as heat shock proteins (HSPs). There are five classes of heat shock proteins found in plants such as;

       HSP class

 Examples (Arabidopsis / prokaryotic)

      Cellular location

 

I) HSP100

 

 

a) AtTCP-1 / GroEL, GroES

 

i) Cytosol

 

II) HSP90

 

 

b) Various AtHSP22, AtHSP20, AtHSP18.2, AtHSP17.6 / IBPA/B

 

ii) mitochondria

 

III) HSP70

 

 

c) AtHSP101 / ClpB, ClpA/C

 

iii) chloroplasts

 

IV) HSP60

 

 

d) AtHSP70 / DnaK

 

iv) endoplasmic reticulum

 

V) smHSP

 

 

e) AtHSP90 / HtpG

 

Match the following HSPs   with their correct location and the examples of the HSPs;
TLS Online TPP Program

#Question id: 854

#SCPH06 I Botany

Many conditions including type 2 diabetes, Alzheimer  disease, Huntington disease and parkinson disease are associated with the misfolding mechanism a soluble protein that is normally secreted from the cell is secreted in the missfold state and converted into an insoluble extracellular fibre the diseases are correctly referred to as
TLS Online TPP Program

#Question id: 3862

#SCPH06 I Botany

The largest gene characterized to date is: