Which of the following is the precursor of  Cytokinin?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 3356

#Unit 11. Evolution and Behavior

Which of the following above way not cause sampling error in succeed generation?

TLS Online TPP Program

#Question id: 27982

#Unit 1. Molecules and their Interaction Relevant to Biology

Reactions catalyzed by FoF1

a. Perform by mechanism of rotational catalysis 

b.. Gamma rotate 120 degree to contact with beta subunit 

c. Gamma rotate 360 degree to contact with beta subunit 

d. beta rotate 120 degree to contact with Gamma

Which of the following is true

TLS Online TPP Program

#Question id: 8889

#Unit 9. Diversity of Life Forms

What would be the most effective method of reducing the incidence of blood flukes in a human population?

TLS Online TPP Program

#Question id: 13139

#Unit 10. Ecological Principles

The logistic equation above is used to describe the rate of change of a population, N, with time, t, where r is the intrinsic rate of increase and K is the carrying capacity. Which of the following statements is true for this equation?