The supercontinent that began to break up during  the Triassic

TLS Online TPP Program

#Question id: 12948

#Unit 13. Methods in Biology

Proteolytic cleavage of DNA polymerase by subtilisin caused loss of its nick translation activity. Which of the following properties is lost?

TLS Online TPP Program

#Question id: 33231

#Unit 1. Molecules and their Interaction Relevant to Biology

Which character makes concerted acid–base catalysis a common enzymatic mechanism?

TLS Online TPP Program

#Question id: 19088

#Unit 4. Cell Communication and Cell Signaling

which of the following toxin causing irreversible opening of stomata?

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 2382

#Unit 2. Cellular Organization

During _________, the phragmoplast vesicles fuse to form the cell plate and later become the cell wall.