Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 12297
TLS Online TPP Program

#Question id: 13056

Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
 Which of the following is true for traditional and real time PCR?

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. Both the techniques allow detection of the product in early stages
  2. Real time PCR can detect the product in early stages as compared to traditional PCR
  3. Both systems require different primers
  4. Both techniques are end point product determination methods

More Questions
TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 
TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14119

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is incorrect regarding sequence homology?
TLS Online TPP Program

#Question id: 14120

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not a variant of BLAST?
TLS Online TPP Program

#Question id: 14121

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not the classification of SCOP?