Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 39223
TLS Online TPP Program

#Question id: 10782

Which one of the following are not shown the characteristics of Saponins_____

#I Life Science/ Life Sciences Group – I-V
  1. steroid and triterpene glycosides, so named because of their soaplike properties
  2. presence of both lipid-soluble (the steroid or triterpene) and watersoluble (the sugar) elements in one molecule gives saponins detergent properties
  3. Phenolic compounds that contain a phenol group—a hydroxyl functional group on an aromatic ring

  4. The toxicity of this compound is thought to be a result of their ability to form complexes with sterols

More Questions
TLS Online TPP Program

#Question id: 14117

#SCPH01 Biochemistry

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#I Life Science/ Life Sciences Group – I-V

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG