Neutrophills containing granules which have protease, protease inhibitors, for example

a) α-1 antitrypsin – regulation of proteases

b) Defensin – Direct harm to pathogen

c) Elastase –  Tissue remodelling

d) MBP – basophil degranulation

TLS Online TPP Program

#Question id: 14488

#Unit 13. Methods in Biology

A man and his wife appear for an interview for two posts. The probability of the husband's selection is 1/7 and that of the wife’s selection is 1/5. The probability that only one of them will be selected is

TLS Online TPP Program

#Question id: 31120

#Unit 2. Cellular Organization

When a membrane is warmed through the transition temperature, Tm, what will happen?

TLS Online TPP Program

#Question id: 19052

#Unit 13. Methods in Biology

Amino acids detected by spraying the plate with ninhydrin solution is an example of

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 16111

#Unit 7. System Physiology – Animal

When environmental temperature is less than body temperature, mechanisms are activated that: