TLS Online TPP Program

#Question id: 13055


Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the following will provide least specific amplification in qPCR?

#Part-A Aptitude & General Biotechnology
  1. Taqman probe
  2. Molecular beacon
  3. SYBR green
  4. a and b both
More Questions
TLS Online TPP Program

#Question id: 14115

#Part-A Aptitude & General Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Part-B Specialized Branches in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG