in sterilization, del factor increases as the final number of cells 

TLS Online TPP Program

#Question id: 2086

#Section 2: General Biology

Which of the following is (are) not present in biomembranes?

TLS Online TPP Program

#Question id: 641

#Section 2: General Biology

Which of the following does NOT describe a mechanism that cells use to regulate enzyme activities?

A. Cells control enzyme activity by phosphorylation and dephosphorylation.

B. Cells control enzyme activity by the binding of small molecules.

C. Cells control the rates of diffusion of substrates to enzymes.

D. Cells control the rates of enzyme degradation.

E. Cells control the rates of enzyme synthesis.

F. Cells control the targeting of enzymes to specific organelles. 

TLS Online TPP Program

#Question id: 4128

#Section 3: Genetics, Cellular and Molecular Biology

Which of the following statements about tRNA molecules is false?

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 13071

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Modifications of the agglutination reaction involve the use of ________particles, which allow the reaction to be observed more easily in the liquid phase