When a plant cell, such as one from a tulip leaf, is submerged in a hypertonic solution, what is likely to occur?

TLS Online TPP Program

#Question id: 1321

#Section 3: Genetics, Cellular and Molecular Biology

Gap junction allows exchange of

TLS Online TPP Program

#Question id: 3726

#Section 3: Genetics, Cellular and Molecular Biology

What is a reasonable length for an RNA primer in E. coli?

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14798

#Section 5: Bioprocess Engineering and Process Biotechnology

Match the microbial growth characteristics in column I with the corresponding features in column II.

Column I                                                                                        Column II

A. Growth associated product formation.                  1. Specific growth rate decreases with increasing product concentration.

B. Growth associated product formation                    2. Specific product formation rate is constant

C. Product inhibition                                                        3. Specific product formation rate is proportional to Specific growth rate.

D. Substrate inhibition                                                     4. Specific growth rate decreases with increasing substrate concentration. 

TLS Online TPP Program

#Question id: 4909

#Section 3: Genetics, Cellular and Molecular Biology

A pattern of transmission where all offspring have the same phenotype as their mother is consistent with which type of non-Mendelian inheritance?