Mitosis occurs when mixing lymphocytes of two individuals:

TLS Online TPP Program

#Question id: 1691

#Section 2: General Biology

What is the structure recognized by the αβ T-cell receptor on the cell surface of an antigen-presenting cell?

TLS Online TPP Program

#Question id: 3254

#Section 3: Genetics, Cellular and Molecular Biology

Consider a single locus with 2 alleles which are at Hardy-Weinberg equilibrium. If the frequency of the heterozygous genotypes is 0.42, what is the frequency of one homozygote in the population?

TLS Online TPP Program

#Question id: 3003

#Section 2: General Biology

Which statement best characterizes the behavior of a bacterial culture during EXPONENTIAL GROWTH?

TLS Online TPP Program

#Question id: 3260

#Section 3: Genetics, Cellular and Molecular Biology

Consider a diploid population at Hardy-Weinberg equilibrium. For a locus with two alleles, the frequency of the A1A1 genotype is 0.04) The frequency of A2 allele is

TLS Online TPP Program

#Question id: 13095

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.