You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 4729

#Section 3: Genetics, Cellular and Molecular Biology

In the following example, 3 independently assorting genes A, B and C are known to govern coat color in mice. Homozygous recessive cc (albino phenotype) is epistatic over both gene A and B, What will be the expected frequency of non albino, in the progeny from cross of AaBbCc with genotype of AABbCc?

#Question id: 4730

#Section 3: Genetics, Cellular and Molecular Biology

Cross is made between a pure breeding plant having red coloured male flowers with a pure breeding plant having white colored female flowers. All of these offspring are white colored flower. Upon selfing of these F1 red flower plant produced both red and white flower. Which of the following is conclusion of these cross?

#Question id: 4731

#Section 3: Genetics, Cellular and Molecular Biology

A pure-breeding strain of squash that produced disk-shaped fruits was crossed with a pure breeding strain having long fruits. The F1 had disk fruits, but the F2 showed a new phenotype, sphere, and was composed of the following proportions

Disk  384            

Sphere 96

 Long  32

What is reason for F2 phenotype?

#Question id: 4732

#Section 3: Genetics, Cellular and Molecular Biology

What is F2 phenotype ratio observed when a homozygous recessive mutation in either or both of two different genes results in the same mutant phenotype?

#Question id: 4733

#Section 3: Genetics, Cellular and Molecular Biology

If a homozygous plant with red peppers is crossed with a homozygous plant with green peppers, all the F1 plants have red peppers. When the F1 are crossed with one another, the F2 are in a ratio of 9 red : 3 brown : 3 yellow : 1 green  due to

#Question id: 4735

#Section 3: Genetics, Cellular and Molecular Biology

In corn, three dominant alleles, called A, C, and R, must be present to produce colored seeds. Genotype A/–; C/– ; R/– is colored; all others are colorless. A colored plant AaCCRr is crossed with colorless plant aaCcRr. What proportional of offspring plant with colorless seed?