Practice Questions

TLS Online TPP Program

#Question id: 13101

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

70% Identity
10% Identity
80% Identity
90% identity

More Questions

TLS Online TPP Program

#Question id: 1684

#Section 2: General Biology

What are the molecules mediating signal transduction following antigen binding to cell surface immunoglobulin on a B-cell called?

TLS Online TPP Program

#Question id: 13055

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Precision will be reduced, but yield will be increased

Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.

Which of the following will provide least specific amplification in qPCR?

TLS Online TPP Program

#Question id: 19958

#Section 5: Bioprocess Engineering and Process Biotechnology

What is the role of glucose isomerase?

TLS Online TPP Program

#Question id: 10791

#Section 6: Plant, Animal and Microbial Biotechnology

Following are certain statements regarding furanocoumarins;

a) furanocoumarins have an attached furan ring

b) These compounds are toxic until they are activated by sunlight in the ultraviolet A (UV-A) region (320–400 nm)

c) Light activated furanocoumarins can insert themselves into the double helix of DNA and bind to the pyrimidine bases, thus blocking transcription and repair and leading eventually to cell death

d) Phototoxic furanocoumarins are especially abundant in members of the Umbelliferae family, including celery, parsnip, and parsley.

Which of the following combination from the above statements is correct?

TLS Online TPP Program

#Question id: 14174

#Section 5: Bioprocess Engineering and Process Biotechnology

The growth of baker’s yeast (S. cerevisiae) on glucose may be simply described by the following equation:

In a batch reactor of volume 10^5 l, the final desired yeast concentration is 50 gdw/l. Using the above reaction stoichiometry, Determine the total amount of oxygen required?

________________