Precision will be reduced, but yield will be increased

Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.

In blue white screening insertional activation of Beta-D-galactosidase will give rise to

TLS Online TPP Program

#Question id: 3288

#Section 3: Genetics, Cellular and Molecular Biology

Migration causes changes in the allelic frequency of a population by introducing alleles from other populations. The magnitude of change due to migration depends on

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14787

#Section 1: Engineering Mathematics

TLS Online TPP Program

#Question id: 15940

#Section 1: Engineering Mathematics

If  the matrix A is such that 

Then the determinant of A is equal to ____

TLS Online TPP Program

#Question id: 4919

#Section 3: Genetics, Cellular and Molecular Biology

Genes for cytoplasmic male sterility in plants are generally located in