TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14117
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14118
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 14119
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which of the following is incorrect regarding sequence homology?
TLS Online TPP Program
#Question id: 14120
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which of the following is not a variant of BLAST?
TLS Online TPP Program
#Question id: 14121
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which of the following is not the classification of SCOP?
TLS Online TPP Program
#Question id: 14122
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which of the statement is incorrect about SCOP?
