TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14117
#SCPH01 Biochemistry
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14117
#I Life Science/ Life Sciences Group – I-V
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14117
#SCPH05 I Biotechnology
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14117
#SCPH05 I Biotechnology
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14118
#SCPH01 Biochemistry
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 14118
#I Life Science/ Life Sciences Group – I-V
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
