You have a white eyed, male fruit fly with vestigial wings and a wild type female known to be heterozygous for both traits. You know that vestigial is located on an autosome. What is the probability that a mating between these two flies will generate a female offspring with vestigial wings and white eyes?

TLS Online TPP Program

#Question id: 3871

#SCPH06 I Botany

Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II?

TLS Online TPP Program

#Question id: 19211

#SCPH06 I Botany

Test strips are used to detect glucose in blood/urine of diabetes patients. The strip contains glucose oxidase, a weekly colored chromogen along with an enzyme.

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 3517

#SCPH12 I Genetics

The following two genotypes are crossed: AaBbCcddX AabbCcDd. What will number of different genotypes among the progeny of this cross?

TLS Online TPP Program

#Question id: 17209

#I Life Science/ Life Sciences Group – I-V

Which one of the following is a database of protein sequence motifs?