Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 23935
TLS Online TPP Program

#Question id: 21008

Which of the following statement is correct for defined media?

#Part-B Specialized Branches in Biotechnology
  1. Media that contain natural compounds whose chemical composition is not exactly known
  2. Media that contain specific amounts of pure chemical compounds with known chemical compositions  
  3. Media that contain chemical compounds whose chemical composition is not exactly known
  4. None of the above.
More Questions
TLS Online TPP Program

#Question id: 14116

#Part-B Specialized Branches in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 
TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 
TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG