Cholesterol mixes with phospholipids in a biomembrane because cholesterol molecules are

TLS Online TPP Program

#Question id: 205

#Section 2: General Biology

Which coenzyme is composed of a 2-mercaptoethylamine unit, the vitamin pantothenate and an ADP moiety? 

TLS Online TPP Program

#Question id: 3015

#Section 2: General Biology

All the bacterial cells that result from the replication of a single original bacterial organism are said to be a

TLS Online TPP Program

#Question id: 14934

#Section 5: Bioprocess Engineering and Process Biotechnology

E. coli was continuously cultured in a continuous stirred tank fermenter with a working volume of 1.0 I by chemostat. A medium containing 4.0 g1^-1 of glucose as a carbon source was fed to the fermenter at a constant flow rate of 0.5 I h^-1, and the glucose concentration in the output stream was 0.20 g I^-1. The cell yield with respect to glucose YxS was 0.42 g dry cells per gram glucose. Determine specific growth rate 

TLS Online TPP Program

#Question id: 13101

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 18966

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Select the best algorithm to do pairwise alignment when two proteins are closely related and very similar in length.