Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 41407
TLS Online TPP Program

#Question id: 4343

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If a researcher moves the repressor gene (lacI), along with its promoter, to a position at some several thousand base pairs away from its normal position, which of the following results would be expected?

#SCPH05 I Biotechnology

  1. The repressor will no longer bind to the operator.

  2. The repressor will no longer bind to the inducer.

  3. The lac operon will be expressed continuously.

  4. The lac operon will function normally.

More Questions
TLS Online TPP Program

#Question id: 14117

#I Life Science/ Life Sciences Group – I-V

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG