An animal cell lacking carbohydrates on the external surface of its plasma membrane would likely be impaired in which function?

TLS Online TPP Program

#Question id: 14601

#Section 2: General Biology

Facilitated diffusion and active transport

TLS Online TPP Program

#Question id: 1144

#Section 3: Genetics, Cellular and Molecular Biology

Which of the following is NOT a common intracellular second messenger?

TLS Online TPP Program

#Question id: 1618

#Section 2: General Biology

Which of the following is NOT an acute phase protein?

TLS Online TPP Program

#Question id: 3628

#Section 3: Genetics, Cellular and Molecular Biology

Two mutant plants, both bearing white flowers, were crossed. All F1 plants had red colored flowers. Which one of the following conclusions is correct?

TLS Online TPP Program

#Question id: 13096

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?