TLS Online TPP Program

#Question id: 1679


What is the molecular weight of MHC class II β chain?

#Section 2: General Biology
  1. 28–29 kDa

  2. 34 kDa

  3. 43–44 kDa

  4. 11–12 kDa

More Questions
TLS Online TPP Program

#Question id: 13099

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. 
 
Choose correct 30-nt-long DNA sequence with the help of above-mentioned fragments

TLS Online TPP Program

#Question id: 13100

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 13101

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 13102

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.) 
You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.
 

 Why is it that having more repeats leads to a band that is higher in the gel?

TLS Online TPP Program

#Question id: 13103

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.) 
You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.
 
 

Why is it that some people show only one band?

TLS Online TPP Program

#Question id: 13104

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.) 
You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.
 

 
Why is it that some people show two bands?