Nitrate reductase is an important enzyme for nitrate assimilation. Given below some regulation of nitrate reductase activity through phosphorylation and dephosphorylation.

a) Light, and other environmental factors stimulate a protein phosphatase that dephosphorylates a key serine residue in the hinge 1 region of nitrate reductase and thereby activates the enzyme

b) In Dark, and Mg2+ stimulate a protein kinase that phosphorylates the same serine residues, which then interact with a 14-3-3 inhibitor protein, and thereby inactivate nitrate reductase

c) In Light, and Mg2+ stimulate a protein kinase that phosphorylates the serine residues, and thereby activate nitrate reductase

d) In Dark, and other environmental factors stimulate a protein phosphatase that dephosphorylates a key serine residue in the hinge 1 region of nitrate reductase and thereby inactivates the enzyme

Which of the following statements about regulation of nitrate reductase is correct?

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#SCPH01 Biochemistry

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#I Life Science/ Life Sciences Group – I-V

Which of the following is incorrect regarding sequence homology?