TLS Online TPP Program

#Question id: 12845


The perimeter of a rhombus is 240 metre and the distance between any two parallel sides is 20 metre. The area of the rhombus in square metre is

#General Aptitude
  1. 600 square metre
  2. 1200 square metre
  3. 2400 square metre
  4. 4800 square metre
More Questions
TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 7570

#General Aptitude

Every Sunday, Giri jogs 3 miles. For the rest of the week, each day he jogs 1 mile more than the previous day. How many miles does giri jog in 2 weeks?

TLS Online TPP Program

#Question id: 11904

#Unit 7. System Physiology – Animal

Which of the following changes would be expected in a patient with diabetes insipidus due to a lack of antidiuretic hormone (ADH) secretion?


TLS Online TPP Program

#Question id: 24565

#Unit 8. Inheritance Biology

A particular trait that are determined by autosomal genes and are inherited according to Mendel’s principles, this particular trait has higher penetrance in one of the sexes is known as

TLS Online TPP Program

#Question id: 31246

#Unit 5. Developmental Biology

In inducing limb growth Fgf8-secreting beads can substitute for the: