The dissolved oxygen concentration during the measurement of K_La by sodium sulphite method is

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Part-B Specialized Branches in Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#Part-A Aptitude & General Biotechnology

Which of the following is incorrect regarding sequence homology?