E. coli was continuously cultured in a continuous stirred tank fermenter with a working volume of 1.0 I by chemostat. A medium containing 4.0 g1^-1 of glucose as a carbon source was fed to the fermenter at a constant flow rate of 0.5 I h^-1, and the glucose concentration in the output stream was 0.20 g1^-1, The cell yield with respect to glucose YxS was 0.42 g dry cells per gram glucose. Determine the cell concentration in the output stream 

TLS Online TPP Program

#Question id: 5561

#I Life Science/ Life Sciences Group – I-V

In sea urchins, the "fast block" and the longer lasting "slow block" to polyspermy, respectively, are ________.

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 3512

#SCPH28 | Zoology

How many different type of gamete produced by plant having genotype AABBccDd?

TLS Online TPP Program

#Question id: 3908

#SCPH28 | Zoology

Which of the following is correct?

TLS Online TPP Program

#Question id: 3643

#SCPH28 | Zoology

One DNA strand, the______________, is made continuously in a 5→3 direction from the origin.